Welcome

Anti Essays offers essay examples to help students with their essay writing.

Sign Up

Gene Mutation Essay

Open Document

Below is an essay on "Gene Mutation" from Anti Essays, your source for research papers, essays, and term paper examples.

Activity Gene Mutations
1 Normal Condition
  a) AUGAAGCGGCAACCACAUCAUAAAAAGGGAACCAUGCCC
  b) Methionine, lysine, arginine, glutamine, proline, histidine, histidine, lysine, lysine, glycine, threonine, methionine, proline.
2 Mutation deletions
  a) AUGAAGCGGCACCACAUCAUAAAAGGGAACCAUCCC
  b) Methionine, lysine, arginine, histidine, histidine, isoleucine, isoleucine, lysine, arginine, glutamate, proline, cysteine, C-C
  c) The codon on the right end is incomplete and will attach to the next nitrogen base.
  d) The result is that all of the codons will be shifted forward altering the production of peptides so the peptides needed for survival won’t be made. This also effects the end codon as the end codon won’t be produced therefor the peptides will grow prolifically.
  e) The D.N.A would fail to make the protein for that particular codon, but the stop codon will still be in place as it won’t be affected.
  f) A single base pair deletion would have more of an effect because when one base pair is deleted, everything behind the one deleted base pair is out of order and affected.
3 Mutation additions
  a) AUGAAGCGGCAACCACAAUCAUAAAAAGGGAACCAUGCCC
  b) Methionine, lysine, arginine, glutamine, proline, glutamine, serine, stop
  c) The addition created an early stop codon, so the original necessary proteins after the stop codon won’t be made.
4 Mutation Substitutions
  a) AUGAAGCGGCAACCACAUCAUAAAAAGGGAACCACGCCC
  b) Methionine, lysine, arginine, glutamine, proline, histidine, histidine, lysine, lysine, glycine, threonine, threonine, proline
  c) The codon involved would be GAA and the first adenine base will be substituted by a guanine base so it would turn out to be GGA.
5.
a) The adenine in the glutamate codon is substituted by uracil.
b) Both adenine bases from glutamate GAA will be substituted for uracil to produce valine of GUU.
c) The single base substitution is most likely to occur.

Conclusion:
I think the most harmful mutation...

Show More


Citations

MLA Citation

"Gene Mutation". Anti Essays. 12 Dec. 2018

<http://snehaedu.com/free-essays/Gene-Mutation-546657.html>

APA Citation

Gene Mutation. Anti Essays. Retrieved December 12, 2018, from the World Wide Web: http://snehaedu.com/free-essays/Gene-Mutation-546657.html